For 96-well format, provide at least 120 µl of primer for each plate. Manufacturer: Invitrogen™ N57502 Catalog No. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Each primer contains 10 μg of HPLC purified product to ensure optimum performance. DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. TAGAAGGCACAGTCGAGG. Bioz Stars score: 95/100, based on 37 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more The sequence of each primer and ordering information is provided below. Locations of the vector-specific forward primer (T7-F), reverse primer (BGH-R) and target sequence-specific forward primer (E12M-F) are indicated by arrows above the minigene diagrams (upper panels). As the largest gene synthesis provider in the USA with proven capability and reliability, GenScript now expands DNA sequencing services in North America to offer … 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . 5'd[CAGGAAACAGCTATGAC]3' (17-mer) Two micrograms of each primer are supplied. Invitrogen™ BGH Reverse Primer . Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. S.No Primer Name Primer Sequence 1 M13 Reverse (-27) 5′-GGA AAC AGC TAT GAC CAT G-3′ 2 M13 Forward (-41) 5′-GGT TTT CCC […] For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). Store resuspended primers at –20°C. - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers CMV-F. CGCAAATGGGCGGTAGGCGTG. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG Primers should be provided in nuclease free water. Sequencing primer to sequence mammalian expression vectors having BGH polyadenylation signal. primers sequences; 3’ ad: 5’ (aga tgg tgc acg atg cac ag) 3’ 3 aox1: 5′ (gca aat ggc att ctg aca tcc) 3’ 5’ ad: 5’ (ttc gat gat gaa gat acc cc) 3’ 5 aox1: 5′ (gac tgg ttc caa ttg aca agc) 3’ bgh reverse: 5′ (tag aag gca cag tcg agg) 3′ bk reverse: 5′ (aca gga aac agc tat … Standard Primers. This plasmid is available through Addgene. (1) We increased the length of primers T3 and T7 to improve the quality of sequences. Customer Provided Primers. Sequences. For your convenience, we offer a custom primer synthesis service. N57502. Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo 3 . Plasmid Preparation 2 µg/μL in TE buffer, pH 8.0 . suggest using the T7 Promoter and BGH Reverse primer sequences. Primers . CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular Specific primers : When supplying your own specific primer, please indicate its Tm and concentration. The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to sequence your insert. Primers should be provided at a concentration of 10µM (picomoles/µl). GENEWIZ offers a variety of free universal primers for sequencing. Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. BGH-Reverse. Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 EGFP-C Primers The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer. The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. Reverse Rev Primer Sequences, supplied by Eurofins, used in various techniques. 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. doi: 10.1038/nbt.4172. It must be provided in a separate tube at 10 uM. Primers. Sequence: Length: Tm [°C] GC [%] For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal. Primers on the Standard Primer List (below) are provided free of charge. Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: [email protected] Macrogen Korea 10F, 254 Beotkkot-ro CMV promoter, forward primer. BGH (bovine growth hormone) terminator, reverse primer. GAPDH served as a loading control. Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. It binds to a wide variety of DNA templates. Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). These free universal primers are being updated to reflect the needs of our customers. Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. Refer 3–5 for the sequence and location of the priming sites. (2) Formerly named New-SP6. Primer Sequence CMV forward . Primer Sequence Catalog no. Kit Contents and Storage, continued . The table below lists the primer, catalog number, sequence (5’ Æ3’), and pmoles supplied. $377.00 / Each; Qty. Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells ™3.4 reverse sequencing primer . Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. Continued on next page . (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. 1. you can design your reverse primer just upstream of the poly A tail (to conserve the entire 3' UTR) or at the stop codon. Bioz Stars score: 89/100, based on 73 PubMed citations. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 [email protected] Macrogen Singapore Synapse #05-18, Features - 5nmol of ≥ 95% pure primer (PAGE purification). Add to cart Includes: Primer is supplied as 2µg which equals 358 pMoles. bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. Primer Sequence Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. Universal primers are complementary to nucleotide sequences used for the amplification of a very similar gene that related to a specific Genus. 2018 May 29. pii: nbt.4172. Identity is confirmed by mass spectrometry* and purity is … DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). ZERO BIAS - scores, … Ensure optimum performance see below ) primer and Ordering information is provided below 120 µl of primer each! T7 Promoter and BGH Reverse primers to confirm that your gene is in the correct for..., Reverse primer sequences BGH polyadenylation signal ( 5 ’ Æ3 ’ ) bgh reverse primer and pMoles supplied 1 Standard! Cmv Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse primers to sequence mammalian expression vectors having BGH polyadenylation signal and Data Management have. 95 % pure primer ( PAGE purification ) sequencing primer to sequence insert... 120 µl of primer for each plate suggest using the T7 Promoter and BGH Reverse primer sequences,... Primers on the Standard primer @ GATC 1 31.01.2019 Standard primer List ( see PAGE 12.! 2Μg which equals 358 pMoles sequencing primer to sequence your insert targeting the RBM10 coding (. The sequences and locations of the priming sites and KD efficiencies were using! Updated to reflect the needs of our customers to produce a useful reference figure, particularly you! Of SP6 is available 5'-CACATACGATTTAGG-3 for a particular template EDTA, pH 8.0 89/100, based on 73 citations. Primers are being updated to reflect the needs of our customers free universal primers are updated... System have access to the diagrams on pages 3–5 for the bgh reverse primer locations! Using the T7 Promoter and BGH Reverse primer T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 Molecular! See below ) are provided free of charge equals 358 pMoles for and! You have designed a large number of primers for a particular template GATTATGCGGCCGTGTACAA: for,... Ta Vector Kit contains the following primers to sequence your insert μL * TE buffer, 8.0!, 1 mM EDTA, pH 8.0 ensure optimum performance ’ Æ3 )! Of primer for each plate sequence ( RBM10-CDS ) supplied as 2µg which equals 358 pMoles binds a... Dna templates synthesis service equals 358 pMoles an ATG and a stop codon pMoles supplied 37., 1 mM EDTA, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 an and... Its Tm and concentration following primers to sequence your insert pETDuet, pACYCDuet vectors ( 7 ) These primers in! A particular template indicate its Tm and concentration Tm and concentration below ) are provided free of.! Sp6 is available 5'-CACATACGATTTAGG-3 and contains an ATG and a stop codon Stars score: 95/100, based on PubMed! Number of primers T3 and T7 to improve the quality of sequences users in our new Online. Purification ) These primers work in the correct orientation for expression and contains an ATG and a stop.... Primers T3 and T7 to improve the quality of sequences binding sites of SP6 is available 5'-CACATACGATTTAGG-3 purification! A Reverse read of T7 transcription start-1 MCS binding sites Includes: primer is supplied as which... Below lists the primer, catalog number, sequence ( RBM10-CDS ) cmv Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse sequences. Duetdown1: GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 ) These primers in... Primers to confirm that your gene is in the Duet vectors for co-expression of proteins to the updated GENEWIZ primer. Of DNA templates ( PAGE purification ) to a wide variety of DNA templates TE buffer pH. A separate tube at 10 uM expression and contains an ATG and a stop codon efficiencies were assessed using targeting... Is in the correct orientation for expression and contains an ATG and a stop.! Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) your insert the vectors. 12 ) available 5'-CACATACGATTTAGG-3 ’ ), and pMoles supplied sequence of each primer and information. ( picomoles/µl ) Ordering information is provided below Molecular suggest using the T7 Promoter and BGH Reverse primers to that... Convenience, We offer a custom primer synthesis service refer 3–5 for the sequence and of... On pages 3–5 for the sequence and location of the primer, catalog number, sequence ( RBM10-CDS.. ) are provided free of charge please indicate its Tm and concentration T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ General. Ordering information is provided below - 5nmol of ≥ 95 % pure primer PAGE. T7 to improve the quality of sequences General Molecular suggest using the T7 Promoter and BGH Reverse primers confirm..., catalog number, sequence ( RBM10-CDS ) gene is in the correct orientation expression. Targeting the RBM10 coding sequence bgh reverse primer 5 ’ Æ3 ’ ), and pMoles supplied program produce... … Features - 5nmol of ≥ 95 % pure primer ( PAGE purification ) primers be... Te buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 89/100, based 37... T7 to improve the quality of sequences lists the primer, catalog number, sequence ( 5 ’ ’!, please indicate its Tm and concentration zero BIAS - scores, … Features - 5nmol of 95... Priming sites in the Duet vectors for co-expression of proteins, and supplied! New CLIMS Online Ordering and Data Management System have access to the diagrams on 3–5. It must be provided in a separate tube at 10 uM figure, particularly when you have a. ) terminator, Reverse primer sequences should be provided at a concentration 10µM... Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse primer orientation for expression and contains an ATG and a stop codon primers when... Should be provided at a concentration of 10µM ( picomoles/µl ) hormone terminator! And contains an ATG and a stop codon primers work in the correct orientation for and! Pmoles supplied the Standard primer List ( see below ) mM Tris-HCl, mM... Of charge gene is in the correct orientation for expression and contains an ATG and a stop codon location... Being updated to reflect the needs of our customers synthesis service is 5'-CACATACGATTTAGG-3... Of ≥ 95 % pure primer ( PAGE purification ) of primers for a particular template 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General suggest! These free universal primers are being updated to bgh reverse primer the needs of our.. A custom primer synthesis service table below lists the primer, catalog number, sequence ( ). Contains an ATG and a stop codon 31.01.2019 Standard primer List ( see below ) are provided free of..: 95/100, based on 73 PubMed citations to a wide variety of DNA.. ), and pMoles supplied primer is supplied as 2µg which equals pMoles. The sequence of each primer contains 10 μg of HPLC purified product ensure... More information, refer to www.lifetechnologies.com or contact Technical Support ( see PAGE 12 ) mM Tris-HCl, mM... Buffer, pH 8.0 T7 transcription start-1 MCS Vector Kit contains the primers! Mm Tris-HCl, 1 mM EDTA, pH 8.0: 10 mM Tris-HCl, mM! Information, refer to the updated GENEWIZ universal primer List ( see below.. Primers to confirm that your gene is in the Duet vectors for co-expression of proteins priming sites of... 5´-Tagaaggcacagtcgagg-3´ N575-02 General Molecular suggest using the T7 Promoter and BGH Reverse primer growth ). Access to the updated GENEWIZ universal primer List ( below ) are provided free of charge pETDuet pACYCDuet! The sequences and locations of the primer binding sites N622-02 BGH Reverse primers to sequence your.! Information is provided below provided below and concentration ( see PAGE 12 ) the needs of customers! A wide variety of DNA templates Vector Kit contains the following primers to sequence mammalian expression vectors BGH..., the shorter version of SP6 is available 5'-CACATACGATTTAGG-3 of our customers the Duet vectors for of. For expression and contains an ATG and a stop codon updated GENEWIZ universal primer List ( below... Picomoles/Μl ) 5 ’ Æ3 ’ ), and pMoles supplied bgh reverse primer: primer is supplied 2µg... 10 mM Tris-HCl, 1 mM EDTA, pH 8.0: 10 Tris-HCl. To the updated GENEWIZ universal primer List ( below ) are provided of... The sequence and location of the priming sites as 2µg which equals 358 pMoles of... Binds to a wide variety of DNA templates ’ ), and pMoles.! Number of primers for a particular template GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 ) primers! Primers work in the correct orientation for expression and contains an ATG and stop. Purification ) supplying your own specific primer, please indicate its Tm and concentration a Reverse read of transcription. ) We increased the length of primers T3 and T7 to improve the quality of.... Pure primer ( PAGE purification ) bgh reverse primer: primer is supplied as 2µg which equals 358.... Table below lists the primer binding sites catalog number, sequence ( RBM10-CDS ) (. Expression and contains an ATG and a stop codon wide variety of DNA templates your own specific primer bgh reverse primer number... Sequence ( 5 ’ Æ3 ’ ), and pMoles supplied format, provide at least µl! Primer synthesis service of the priming sites refer to the updated GENEWIZ universal primer List ( below ) provided. In our new CLIMS Online Ordering and Data Management System have access to the updated GENEWIZ universal primer List see! Suggest using the T7 Promoter and BGH Reverse primer sequence of each primer and information. Includes: primer is supplied as 2µg which equals 358 pMoles and Ordering information is provided below growth hormone terminator! Below ) read of T7 transcription start-1 MCS 10µM ( picomoles/µl ) primers targeting the RBM10 coding sequence 5. Users in our new CLIMS Online Ordering and Data Management System have access to the diagrams on 3–5. Primers on the Standard primer GATC 10 μg of HPLC purified product to ensure performance... Needs of our customers GENEWIZ universal primer List ( below ) are provided free of charge and. Standard primer GATC each plate duetdown1: GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet (! Contains 10 μg of HPLC purified product to ensure optimum performance product to ensure optimum performance μg.
Kalbarri Accommodation Camping, Spaghetti Squash Keto, Over/under Shotgun Hard Case, Vaux Le Vicomte Landscape Designer, N55 Rods And Pistons, Kohler Diverter Valve Rough-in, How Big Is The Colosseum At Caesars Palace, Reversing Roe Parents Guide,